Concentration, Extraction and Detection of Enteric Viruses from Food and Appendices

Chapter 26

Authors
Jacquelina Williams-Woods
Rachel Rodriguez
Joey Marchant
Angela Gail Swinford
William Burkhardt III
See Also
Chapter 26
PDFs
Appendices
Chapter 26
Last Updated
2026-06-01
Reading Time
48 minute(s)
Word Count
9447 words

Table of Contents

Ancestors

Siblings

Sitemap

Terminology

?

Overview

?

Chapter 26

Introduction

Virus associated outbreaks due to the consumption of contaminated food occur annually in the US and nearly all of these outbreaks are due to human norovirus and/or hepatitis A virus (HAV) (1). Detection of viruses in implicated foods is challenging because of the low level of viral contamination, inefficient extraction from food matrices, and the inability to enrich viruses-an aspect beneficial to most bacterial methodologies. These factors necessitate that isolated virus particles be sufficiently concentrated in order to detect their presence in foods. Such limitations can hinder surveillance and outbreak investigations. Inherently, advances in molecular detection techniques such as reverse transcription (RT)-PCR and real-time RT-q(quantitative)PCR (2, 3)
have been shown to offer specificity and sensitivity for foodborne pathogen detection.

The development of virus concentration methods utilizing ultracentrifugation combined with innovative extraction and molecular based detection methods has been successful in virus research, foodborne virus outbreaks, and surveillance studies. Ultracentrifugation, in combination with varying buffers containing amino acids to dissociate viruses from the food is the premise for the FDA foodborne virus concentration and extraction methodologies described within this chapter. These produce and seafood methods, apart from the molluscan shellfish method, utilize a rinse step prior to concentration. The principle of these methods allows the recovery of intact, potentially infectious virus particles which can be assessed for viability. In addition, specific steps are included in each method to reduce the presence of substances which can cause inhibition of molecular based detection methods. Efficient methods for detection of enteric viruses in these food matrices are important for outbreak response and as such, these methods focus on produce and seafood, the leading commodities associated with foodborne enteric virus outbreaks (4).

The concentration and extraction protocols are coupled with RT-qPCR detection using established primers and hydrolysis probes (5, 6, 7, 8). The norovirus, HAV, and murine norovirus (extraction control) RT-qPCR assays were developed and validated for use on the Cepheid SmartCycler® and AB 7500 platforms. The Smart Cycler platform is no longer in use and the protocols are available in Appendix I and the archived Chapter 26B. The norovirus RTqPCR assay simultaneously detects human norovirus genogroups I and II (GI and GII). In addition, a mengovirus multiplex RT-qPCR assay was developed for use as an alternate extraction control (to murine norovirus) and is included for analysis on the AB 7500. All assays incorporate an internal amplification control to prevent the reporting of false negatives results due to inhibition or failure of the RT-qPCR. These multiplexed detection assays were validated for the qualitative detection of norovirus GI, GII, and HAV nucleic acids and can be used for detection of these viruses from any food matrix. Valid sample results are contingent upon the detection of the murine norovirus or mengovirus extraction control from the sample being tested for norovirus GI, GII, and/or HAV. The validation results, data analysis, and supplemental material associated with the concentration, extraction, and detection assays are available in the appendices.

SECTION A: VIRUS CONCENTRATION AND EXTRACTION

Section A1: Concentration and Extraction of Enteric Viruses from Green Onion and Leafy Greens

  1. Tare and weigh 50 g ± 2 g of produce cut in 2-5" pieces into a Whirl-Pak filter bag.

Include all parts of the produce present including roots to leaves.

  1. Add 100 µl extraction control to sample (Section A5).
  2. Add 55 mL ± 2 ml of Glycine Buffer pH 7.6 (Section A6) and seal.
  3. Shake at 200 rpm for 15 min at room temperature.
  4. Pipette liquid into a clean 50 ml conical tube. Let bag sit for 2-3 min and pipette remaining liquid into the same 50 ml conical tube.

Do not squeeze bag to obtain more buffer. This will lead to RT-qPCR assay inhibition.

  1. Centrifuge at 9,000 x g for 30 min at 4 ± 2 ºC.
  2. Pipette supernatant into a clean 70 ml Ultra-centrifuge tube being careful not to disturb pellet and other debris.
  3. Bring total volume up to 65 ml or 125 g total weight (includes bottle and cap) with addition Glycine Buffer, pH 7.6.
  4. Balance tubes to within 0.05 g of each other using Glycine Buffer, pH 7.6.

Minimum volume for ultracentrifugation using Fiberlite rotor and tubes is 50 ml, add glycine/NaCl buffer to bring volume to ≥ 50 ml.

  1. Centrifuge 170,000 x g for 60 min at 4 ± 2 ºC.
  2. Slowly decant supernatant (should see pellet on side of tube), let tubes sit for 4-5 min, then remove and discard remaining liquid with a disposable transfer pipette.
  3. Add 280 µl of Glycine Buffer pH 7.6 to tube and use a disposable transfer pipette to carefully resuspend sample (do not draw all contents at once into pipette). Evenly distribute sample into two 2.0 ml DNase/RNase free tubes.

If sample pellet plus buffer is larger than 0.5 ml, refer to Qiagen QIAamp Viral RNA Mini Kit manual instructions on how to proceed with larger samples volumes.

  1. Store these sample concentrates at ≤ -70 °C or proceed directly to RNA extraction.

Only 1 tube is required for RNA extraction. The remaining tube should be stored at ≤ -70 °C as reserve for possible future analysis.

RNA Extraction

Before starting RNA extraction warm buffer AVE in a 70 ºC heating block.

  1. Add 560 µl prepared Buffer AVL with carrier RNA (Section A6) to sample concentrate tube (if concentrate is frozen, allow thawing at room temperature).
  2. Incubate at room temperature (15-25 °C) for 10 min.
  3. Resuspend pellet by pipetting up and down and vortexing.
  4. Transfer 700 µl of supernatant to the QIAshredder column.
  5. Centrifuge 2 min at maximum speed (≥ 16,000 x g) in a microcentrifuge.
  6. Carefully transfer the supernatant of the flow-through fraction to a new 2.0 ml low retention/siliconized DNase/RNase free microcentrifuge tube without disturbing the cell-debris pellet (if present) in the collection tube.
  7. Add 560 µl of 95-100% ethanol to the cleared lysate, close tube and mix immediately by inverting 3 times. Do not centrifuge. Continue without delay to next step.
  8. Apply 630 µl of the solution to an QIAamp mini column.
  9. Centrifuge 8,000 x g for 1 min. Place QIAamp spin column in new collection tube. Discard flow through and collection tube.
  10. Continue to add sample until the entire sample has been passed through the column, discarding the collection tube each time.
  11. Transfer the QIAamp mini column into a new 2 ml collection tube. Add 500 µl Buffer AW1. Centrifuge 1 min at 8,000 x g. Discard flow through and collection tube.
  12. Transfer the QIAamp mini column into a new 2 ml collection tube. Pipet 500 µl Buffer AW2 onto the QIAamp Mini column. Centrifuge at maximum speed (≥ 16,000 x g) for 3 min. Discard flow through and collection tube.
  13. Transfer the QIAamp mini column into a new 2 ml collection tube. Centrifuge at maximum speed (≥ 16,000 x g) for 1 min to dry column.
  14. To elute RNA, transfer the QIAamp mini column in to a new 1.5 ml low retention/siliconized DNase/RNase free centrifuge tube. Add 50 µl of pre-heated (70 ºC) Buffer AVE directly onto the QIAamp silca-gel membrane. Close the tube gently, and centrifuge for 1 min at 8,000 x g.
  15. Add an additional 50 µl of pre-heated Buffer AVE to column. Pipette the eluted 50 µl back to the top of the column. Close the tube gently, and centrifuge for 1 min at 8,000 x g.
  16. Proceed with RT-qPCR or freeze at ≤ -70 °C for storage.

Section A2: Concentration and Extraction of Enteric Viruses from Soft Fruit: Fresh and Frozen

See Attached

Section A3: Concentration and Extraction of Enteric Viruses from Molluscan Shellfish

See Attached

Section A4: Concentration and Extraction of Enteric Viruses from Scallops and Finfish

See Attached

Section A5: Extraction Control Preparation

Sample Extraction Control Preparation (Murine Norovirus and Mengovirus)

The murine norovirus and mengovirus extraction control propagated in-house typically yields a titer of 105 PFU/ml. Murine norovirus and mengovirus purchased from ATCC or other commercial entity may have titers expressed as TCID50. The target concentration for the extraction control added to each sample will be ~103 PFU/g which will yield Ct’s between 30-37. Instructions for appropriate dilutions of virus stocks in t.c. PBS with 20% glycerol is listed below.

  1. Defrost thoroughly, on ice, extraction control virus stock solution and vortex for 5 sec.
  2. Spin for 2 sec in a microcentrifuge to bring solution to bottom of tube.
  3. Prepare one, 1:10 dilution blank for extraction control virus; 900 µl of t.c. PBS with 20% glycerol (Section A6).
  4. Add 100 ul of extraction control stock solution to 900 µl dilution blank and vortex for 5 sec.
  5. Spin for 2 sec in a microcentrifuge to bring solution to bottom of tube.
  6. Aliquot in 110 µl volumes for future use. These aliquots are considered your diluted stocks of the extraction control.

Aliquots can be frozen for future matrix (sample)seeding, but titer will diminish after multiple freeze-thaw cycles. A 100 µl aliquot of this dilution serves as the extraction control mentioned in the virus protocols. Please be mindful that the extraction control (MNV or mengovirus) is added to samples to determine if extractions were performed correctly and not to establish the sensitivity of the assay. This is a qualitative assay only.

The optimal range for the detection of the diluted extraction control working stock is 30-37 Cts. Due to degradation, the titer for can decrease overtime. When there is a trend where the extraction Ct averages are above 37 Ct with two consecutive runs and there is an absence of inhibition, a new aliquot of the diluted extraction control should be made and used as the extraction controls during sample analysis. Although the extraction control is not required to cross the threshold on or before 37 cycles for the run to be considered valid, this step is being recommended as a QA/QC step for maintaining optimal working stocks of the extraction control. All diluted working stocks of the extraction should be stored in a non-cycling (not frost free) -70 °C freezer to mitigate degradation.

Section A6: Buffers and Recipes

1. t.c. PBS (tissue culture grade) with 20% glycerol
10X PBS
10 ml
Sterile deionized water
90 ml

Obtain sterile container and add 80 ml of PBS and 20 ml volume of glycerol. Filter sterilize using a 0.22 µm filter. Store at 4 ± 2 °C

2. Glycine Solution, pH 7.6
NaCl
8.8 g
Glycine
56.3 g
Deionized water
800 ml

QS to make 1 L with deionized water. Adjust pH to 7.6, sterilize at 121°C for 15 min and store at 4 ± 2 °C.

3. Primer TE (10 mM Tris, 0.1 mM EDTA, pH 8.0)

1 M Tris pH 8.0
0.05 M EDTA
PCR-grade water(DNase/RNase free)
Prepare in sterile 50 ml conical tube. Store at room temperature. 100 µl 20 µl 9.88 ml
22

4. Carrier RNA solution

Buffer AVE 310 µl 310 µg carrier RNA 310 µg

Add 310 µl of buffer AVE to carrier RNA, store in 60 µl aliquots at -20 °C. If carrier RNA is different concentration, the ratio is 1:1 buffer AVE and carrier RNA.

5. AVL Buffer and AVE/Carrier RNA mix

Hydrate carrier RNA with buffer AVE (provided in QIAamp Viral RNA kit). Volumes of Buffer AVL and carrier RNA–Buffer AVE mix required for the number of extractions to be performed (refer to table below).

*Note: Store remaining carrier RNA in 30 µl aliquots at -20 °C.

No. samples Vol. Buffer AVL (ml) Vol. carrier RNA–AVE (µl) No. samples Vol. Buffer AVL (ml) Vol. carrier RNA–AVE (µl) 1 0.56 5.6 13 7.28 72.8 2 1.12 11.2 14 7.84 78.4 3 1.68 16.8 15 8.40 84.0 4 2.24 22.4 16 8.96 89.6 5 2.80 28.0 17 9.52 95.2 6 3.36 33.6 18 10.08 100.8 7 3.92 39.2 19 10.64 106.4 8 4.48 44.8 20 11.20 112.0 9 5.04 50.4 21 11.76 117.6 10 5.60 56.0 22 12.32 123.2 11 6.16 61.6 23 12.88 128.8 12 6.72 67.2 24 13.44 134.4

6. Threonine Buffer

DL-Threonine 59.6 g NaCl 8.8 g

QS to make 1 L with deionized water. Adjust pH to 7.5, sterilize at 121 °C for 15 min and store at 4 ± 2 °C.

7. Glycine/Beef Extract Buffer

Glycine
Beef Extract
Tris Base
Distilled Water
3.75 g 60.0 g 12.0 g 800 ml H20 QS with deionized water to make1 L. Adjust pH to 9.5, sterilize at 121 °C for 15 min and store at 4 ± 2 °C.

8. 2 M Potassium Acetate solution

Potassium Acetate
Distilled Water
39.26 g 150 ml QS to 200 ml with deionized water. Sterilize at 121 °C for 15 min and store at room temperature.

9. Pectinase solution

10,000 U pectinase (Aspergillus niger)
DNase/RNase free PCR grade water
1.25 g 5 ml Prepare and aliquot into dark 1.5 ml tubes, store at 4 ± 2 °C, discard after 6 months.

10. t.c. PBS

10X PBS (Sigma P5493)
Sterile deionized water
Store at 4 ± 2 °C. 100 ml 900 ml Note: Can be used where protocols indicates t.c. PBS or formula below can be used

11. t.c. PBS

NaCl
KCl
KH2PO4
Na2HPO4
8.0 g 0.2 g 0.12 g 0.91 g QS to make 1 L with deionized water. Adjust pH to 7.5, sterilize at 121 °C for 15 min and store at 4 ± 2 °C. 24 Note: Can be used where protocols indicates t.c. PBS or formula above can be used

12. 6 M Guanidine Isothiocyanate (GITC)

GITC (Gibco/BRL 15535-016, 500 g)
7.09 g Aseptically measure 7.09 grams of GITC into a sterile container. Add 4.5 ml of DNase/RNase free water to the container. Mix well until dissolved. A total volume of 10 ml of GITC solution should be noted.
*Note: Store at room temperature in light-occluding DNase/RNase free tubes. Solution stable for 1 month.

13. 5 M NaOH solution

NaOH
QS with sterile deionized water to 40 ml.

14. 2.5 M NaOH solution

NaOH
QS with sterile deionized water to make 40 ml.

15. 50% Ethanol

100% ethanol
8.0 g 4.0 g 5 ml QS with sterile deionized water to make 10 ml. Store at room temperature.

16. Glycine -Tris solution, pH 9.5

Glycine (Sigma G-7126 or equivalent)
Tris Base
Deionized Water
3.75 g 12.0 g 800 ml H20 QS to make 1 L with deionized water. Adjust pH to 9.5, sterilize at 121 °C for 15 min and store at 4 ± 2 °C.

SECTION B: VIRUS DETECTION

Always wear gloves and never wear the same gloves to when going between master mix and samples. Assembly of master mix should be done in a clean master mix PCR hood or BSC hood that has been decontaminated with 10% Bleach solution or HypeWipes followed by 70% Ethanol, or similar product and UV irradiated for 20 min. Change gloves often and when exiting and/or reentering the hood. Always use aerosol resistant pipette tips for PCR.

Section B1: RT-qPCR Detection of Murine Norovirus on AB 7500 Platforms

RT-qPCR Assays
Outlined Murine Norovirus (MNV) RT-qPCR for detection murine norovirus on the AB7500. Primers, probes, and master mix preparation are found in Tables B1.1 and B1.2.
Sample Preparation - Murine Norovirus Protocol
Reverse transcription: 50 °C for 3000 sec (50 min) Polymerase activation: 95 °C for 900 sec (15 min) 45 cycles of: 95 °C for 15 sec, 55 °C for 20 sec, 62 °C for 60 sec with optics on Reaction Set-Up
*Note: Always use aerosol resistant pipette tips for PCR. 1. 2. 3. Thaw primer solutions, probe solutions, and buffer mix and place them in 4 °C bench top cool block or on crushed ice in master mix set up hood. Vortex reagents for 2-3 sec at setting 7-10, and then briefly centrifuge for 3-5 sec in a mini-centrifuge to settle the liquid to the bottom of the tube. Place in ice or bench top cooler. Keep Enzyme Mix in cooling block or on ice at all times, these enzymes should not be defrosted.
Prepare Master Mix for all sample and control reactions as listed in table B2.1 (additional master mix preparations can be found in Appendix E). Keep all thawed components, reagents, controls and master mixes in cooling block or on crushed ice. 26 *Note: Viral RNA templates should be added to reaction tubes in a designated area separate from location where master mixes are prepared. A negative and positive control should be added to each run set-up.
4. 5. 6. 7. Proceed to hood/area or room where the template is added and thaw IAC RNA and sample RNA in the designated hood where the template is added. Briefly centrifuge the tubes 3-5 sec in micro-centrifuge (pulse spin) to settle the liquid at the bottom of the tube. Add appropriate volume of IAC, (0.2 µl/rxn) to Master Mix (keep cold); Vortex briefly & Pulse spin. Add 22 µl Master Mix to each designated reaction tube or sample wells. Add 3 µl of sample template to three designated reaction tubes or sample wells.
Close reaction tubes or seal sample plate once sample and appropriate controls have been added, briefly spin to mix bring down reagents. Instrument Set-up
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Open AB Software (version 2.0-2.3). Fill out the “Experiment Name” field.
Select 7500 (FAST).
Select “Quantitation Standard Curve” Select “TaqMan Reagents” Select “Standard (~3 hours to complete run)” Click “Plate Set Up” Under the “Define Targets” area click on the “Add New Target” until you have 2 targets. Fill Target 1 with MNV, Target 2 with IAC. Change the reporter dye to Cy5 for MNV and TexRd for IAC (do not change quenchers from the default NFQ- MGB). Under Sample section click “Add Samples” until you have the requisite number of samples. Fill in your sample name in each of the areas provided. 13. 27 Click “Assign Targets & Samples” tab and name samples and assign samples to the appropriate well(s). 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. Select FAM as the passive reference dye.
Select “Run Method” The first holding stage is 3000 sec (50 min) at 50 °C. The second holding stage is 900 sec (15 min) at 95 °C. Cycling stage repeats 45 cycles. First stage 15 sec at 95 °C. Second stage 20 sec at 55 °C.
Third stage set at 60 sec (1 min) at 62 °C (click the icon for collecting data at “collect data on hold”). Save the run method – Save as MNV Multiplex. Click the “Analysis” tab on the right. In the upper right corner click on “Analysis Settings.” For “Data Analysis change settings for Cy5 (MNV) and TexRd (Internal Control): Threshold set to 0.1 and “Baseline Start Cycle” to 3 and “End Cycle” to 10. Click “Apply Analysis Settings.” Click “Run” tab on the right. Click green “Start Run” box. Data Interpretation - Murine Norovirus Multiplex Assay 1. Repeat any invalid sample. Sample is “invalid” if: a. b. c. d. The RT-qPCR negative control demonstrates positive Ct results for MNV in Cy5 or if the IAC is negative (no Ct from TxRed), The RT-qPCR positive control is negative (no Ct from Cy5) for MNV, The MNV RT-qPCR is negative (no Ct from Cy5) for any sample, The average of the IAC Ct values for the sample replicates are more than 4.0 Ct’s greater than the negative control IAC Ct value, repeat the RT- 28 qPCR assay using remaining RNA or RNA from a newly extracted tube with a 1 µl template in the RT-qPCR reaction in triplicate. If the 1 µl template reactions yields an average IAC Ct values greater than 4.0 Ct higher than the Negative Control IAC Ct value, repeat the sample analysis from the beginning using additional food sample. With the new sample, the concentrates will be split into 5 tubes and complete RT-qPCR with 1 µl reactions in triplicate. 2. Sample is “valid” and can be reported if: a. b. c. d. RT-qPCR negative control is negative for MNV, RT-qPCR positive control is positive for MNV, RT-qPCR is positive for MNV in all spiked matrices, Internal amplification control (IAC) is positive in all reactions and average of the IAC Ct values for sample is within 4.0 Ct’s of the negative control IAC Ct value. *Note: For MNV, if the average of the IAC Ct values for the sample replicates are more than 4.0 Ct’s greater than the Negative Control IAC Ct value AND the corresponding sample is positive for norovirus and/or hepatitis A virus, the MNV RTqPCR does not have to be repeated. If norovirus or hepatitis A virus is detected in a sample that has inhibition present in the RTqPCR reaction and has log amplification, this sample does not need to be repeated for norovirus or hepatitis A virus RTqPCR and would be considered positive. Repeating RT qPCR reactions due to inhibition is to ensure that you do not have false negatives.
Tables 29 Primers Table B1.1 Primer and Probe Sequences for MNV and Internal Amplification Control
Identificatio n Locationc MNVR2 5’ CAC AGA GGC CAA TTG GTA AA 3’ MNVF 6645-6626 5’- TGC AAG CTC TAC AAC GAA GG -3’
IC46Fa 6520-6539 5’GAC ATC GAT ATG GGT GCC G-3’ IC194Ra N/A 5’-AAT ATT CGC GAG ACG ATG CAG-3’ N/A MNVP Cy5- 5’ CCT TCC CGA CCG ATG GCA TC 3’-IB-RQb IACP 6578-6594 TxR –5’ TCT CAT GCG TCT CCC TGG TGA ATG TG IB RQ 3’ * 2Hewitt, Rivera-Aban, Greening 2009
N/A a Depaola, Jones, Woods et. al. 2010. Internal Amplification Control (IAC) primers and probes are covered by U.S. Patent Application 0060166232. bIB RQ- Iowa Black RQ cbased on accession no. JF320650 30

Table B1.2 AB 7500 Amplification Reaction Components and Master Mix Volume for MNV Reagent Initial Concentratio n Volume per
25 µl reaction Final Concentratio n RNase Free H20 9.8 µl - 5X OneStep RT-PCR Buffer 5X 5.0 µl 1X MgCl2~ 50 mM 0.75 µl 1.5 mM dNTP Mix 10 mM 1 µl 0.4 mM MNVF 10 µM 0.50 µl 0.2 µM MNVR 10 µM 0.50 µl 0.2 µM IC 46F 10 µM 0.1875 µl 0.075 µM IC 194R 10 µM 0.1875 µl 0.075 µM MNVP 10 µM 0.25 µl 0.1 µM IACP 10 µM 0.375 µl 0.15 µM OneStep RT- qPCR Enzyme Mix 1.00 µl
Superasin 20 Units/µl 0.25 µl 5 Units FAM ref dye 500 nM 2 µl 0.04 µM Internal Amplification Control RNA *0.2 µl -

RNA 3 µl
*Amount varies with concentration of IAC RNA. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold (Ct) of 20-25 when no inhibition is present in the reaction. The required concentration was provided to each laboratory participating in the validation study.

˜With the addition of 1.5 mM MgCl2 the final concentration per reaction is 4.0 mM MgCl2

Section B2: RT-qPCR Detection of Hepatitis A Virus on the AB 7500 Platform

RT-qPCR Assay Outlined Hepatitis A Virus RT-qPCR for detection hepatitis A virus on the AB7500. Primers, probes, and master mix preparation are found in Tables B2.1 and B2.2.
Sample Preparation - Hepatitis A Virus Thermo-cycling Protocol
Reverse transcription: 50 °C for 3000 sec (50 min) Polymerase activation: 95 °C for 900 sec (15 min) 50 cycles of: 95 °C for 10 sec, 53 °C for 25 sec, 64 °C for 70 sec with optics on Reaction Set-Up
*Note: Always use aerosol resistant pipette tips for PCR. 1. 2. 3. Thaw primer solutions, probe solutions, and buffer mix and place them in 4 °C bench top cool block or on ice in master mix set up hood. Vortex reagents for 2-3 sec at setting 7-10, and then briefly centrifuge for 3-5 sec in a mini-centrifuge to settle the liquid to the bottom of the tube. Place in ice or bench top cooler. Keep Enzyme Mix in cooling block or on ice at all times, these enzymes should not be defrosted.
Prepare Master Mix for all sample and control reactions as listed in table B2.2 (additional master mix preparations can be found in Appendix F. Keep all thawed components, reagents, controls and master mixes in cooling block. Note: Viral RNA templates should be added to reaction tubes in a designated area separate from location where master mixes are prepared. negative and positive controls should be added to each reaction set-up. 4. 5. Proceed to hood/area or room where the template is added and thaw IAC RNA and sample RNA in the designated hood where the template is added. Briefly centrifuge the tubes 3-5 sec in micro-centrifuge to settle the liquid at the bottom of the tube. Add appropriate volume of IAC, (0.2 µl/rxn) to Master Mix (keep cold); Vortex briefly & Pulse spin. Add 22 µl Master Mix to each designated reaction tube or sample wells. 6. Add 3 µl of sample template to three designated reaction tubes or sample wells.
32 7. Close reaction tubes or seal sample plate once sample and appropriate controls have been added, briefly spin to mix bring down reagents. Instrument Set-Up 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. Open AB Software (version 2.0-2.3). Fill out the “Experiment Name” field. Select 7500 (FAST).
Select “Quantitation Standard Curve” Select “TaqMan Reagents” Select “Standard (~3 hours to complete run)” Click “Plate Set Up” Under the “Define Targets” area click on the “Add New Target” until you have 2 targets. Fill Target 1 with HAV, Target 2 with IAC. Change the reporter dye to Cy5 for MNV and TexRd for IAC (do not change quenchers from the default NFQ- MGB). Under Sample section click “Add Samples” until you have the requisite number of samples. Fill in your sample name in each of the areas providedl Click “Assign Targets & Samples” tab and name samples and assign samples to the appropriate well(s). Select FAM as the passive reference dye.
Select “Run Method” The first holding stage is 3000 sec (50 min) at 50 °C. The second holding stage is 900 sec (15 min) at 95 °C. Cycling stage repeats 50 cycles. First stage 10 sec at 95 °C. 20. Second stage 25 sec at 53 °C.
33 21. 22. 23. 24. 25. 26. 27. 28. Third stage set at 70 sec (1 min 10 sec) at 64 °C (click the icon for collecting data at “collect data on hold”). Save the run method – Save as HAV Multiplex. Click the “Analysis” tab on the right. In the upper right corner click on “Analysis Settings” For “Data Analysis change settings for Cy5 (HAV) and TexRd (Internal Control): Threshold set to 0.1 and “Baseline Start Cycle” to 3 and “End Cycle” to 10. Click “Apply Analysis Settings” Click “Run” tab on the right. Click green “Start Run” box. Data Interpretation - HAV Multiplex Assay For this HAV multiplex assay, Cy5 is the HAV probe fluorescent label and Texas Red (TxR) is the internal amplification control (IAC) probe fluorescent label. 1. 2. 3. Sample is “negative" if: a. b. c. d. e. RT-qPCR negative control is negative for HAV, RT-qPCR positive control is positive for HAV, Matrix control sample (if included) is negative for HAV, Unknown is negative for HAV, Internal amplification control (IAC) is positive. No further analysis is needed. Sample is “positive” if: a. b. c. RT-qPCR negative control is negative for HAV, RT-qPCR positive control is positive for HAV, Unknown sample is positive for the detection HAV. Samples are invalid if: a. If the negative RT-qPCR control sample demonstrates positive results crossing the Cy5 or if the IAC is negative, repeat the RTqPCR assay, 34 a. The average of the IAC Ct values for the sample replicates are more than 4.0 Ct’s greater than the Negative Control IAC Ct value, repeat the RT qPCR assay using remaining RNA or RNA from a newly extracted tube with a 1 µl RT-qPCR reaction in triplicate. If the repeat of the newly extracted sample yields average IAC Ct values 4.0 Ct‘s higher than the Negative Control IAC Ct value, repeat the sample analysis from the beginning using additional food. With the new repeat, the concentrates will be split into 5 tubes and complete RT-qPCR with 1µl reactions in triplicate.
Note: A positive sample is a result that demonstrates log amplification. Log amplification can be viewed as a graph on the ABI 7500 Fast platform. If the sample does not exhibit log amplification and crosses the threshold, the RTqPCR reaction should be repeated. Tables Primers
Table B2.1. Primer and Probe Sequences for HAV and Internal Amplification Control RNA
Identificatio n Location c GAR2F 5’ ATA GGG TAA CAG CGG CGG ATA T 3’ GAR1R 448-469 5’-CTC AAT GCA TCC ACT GGA TGA G-3’
IC46Fa.b 517-537 5’GAC ATC GAT ATG GGT GCC G-3’ IC194Ra,b N/A 5’-AAT ATT CGC GAG ACG ATG CAG-3’ N/A Probes
GARP Cy5- 5’ AGA CAA AAA CCA TTC AAC GCC GGA GG 3’ IB-RQ IACPa,b 483-508 TxR –TCT CAT GCG TCT CCC TGG TGA ATG TG -IB RQ N/A a Internal Amplification Control (IAC) primers and probes are covered by U.S. Patent Application 0060166232 bDepaola, Jones, Woods, et al. 2010. cBased on GenBank accession # M14707 *IB RQ- Iowa Black RQ *Amount varies with concentration of IAC RNA. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold (Ct) at about 20-25 when no inhibition is present in the reaction. The required concentration was provided to each participating laboratory. ˜With the addition of 1.5 mM MgCl2, the final concentration per reaction is 4.0 mM MgCl2

35

Table B2.2. AB 7500 Amplification Reaction Components and Master Mix Volume for HAV Reagent Initial Concentratio n Volume per
25 µl reaction Final Concentratio n RNase Free H20 9.05 µl - 5X OneStep RT-PCR Buffer 5X 5.0 µl 1X MgCl2~ 50 mM 0.75 µl 1.5 mM dNTP Mix 10 mM 1 µl 0.4 mM
GAR2F 10 µM 0.75 µl 0.3 µM GAR1R 10 µM 0.75 µl 0.3 µM IC 46F 10 µM 0.1875 µl 0.075 µM IC 194R 10 µM 0.1875 µl 0.075 µM GARP 10 µM 0.5 µl 0.2 µM IACP 10 µM 0.375 µl 0.15 µM FAM ref dye 500 nM 2 µl 0.04 µM OneStep RT-PCR Enzyme Mix 1.00 µl
Superase·in 20 Units/µl 0.25 µl 5 Units Internal Amplification Control RNA *0.2 µl -

RNA 3 µl
*Amount varies with concentration of IAC RNA. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold (Ct) at about 20-25 when no inhibition is present in the reaction. The required concentration was provided to each participating laboratory.

˜With the addition of 1.5 mM MgCl2, the final concentration per reaction is 4.0 mM MgCl2

Section B3: RT-qPCR Detection of Hepatitis A Virus Control Exclusion Assay on the AB 7500 Platform

RT-qPCR Assays Outlined HAV Control Exclusion Assay for AB 7500 (Primers, probes, and master mix preparation are found in Table B3.1 and B3.2.
*Note: If a 1 µl sample volume was used for the initial HAV RT-qPCR assay due to inhibition, you will use a 1 µl sample volume for this assay. Adjust master mix volumes accordingly. Sample Preparation - HAV Control Exclusion Assay
Reverse transcription: 50 °C for 3000 sec Polymerase activation: 95 °C for 900 sec
50 cycles of: 95 °C for 10 sec, 54 °C for 25 sec, 64 °C for 60 sec with optics on Reaction Set-Up
*Note: Always use aerosol resistant pipette tips for PCR. 1. 2. 3. Thaw primer solutions, probe solutions, and buffer mix and place them in 4 °C bench top cool block or on ice in master mix set up hood. Vortex reagents for 2-3 sec at setting 7-10, and then briefly centrifuge for 3-5 sec in a mini-centrifuge to settle the liquid to the bottom of the tube. Place in ice or bench top cooler. Keep Enzyme Mix in cooling block or on ice at all times, these enzymes should not be defrosted.
Prepare Master Mix for all sample and control reactions as listed in table B3.1 (additional master mix preparations can be found in Appendix F). Keep all thawed components, reagents, controls and master mixes in cooling block or on ice. *Note: Viral RNA templates should be added to reaction tubes in a designated area separate from location where master mixes are prepared. A negative and positive control should be added to each run set-up.
4. Proceed to hood/area or room where the template is added and thaw IAC RNA and sample RNA in the designated hood where the template is added. Briefly centrifuge the tubes 3-5 sec in micro-centrifuge to settle the liquid at the bottom 37 of the tube. Add appropriate volume of IAC, (0.2 µl/rxn) to Master Mix (keep cold); Vortex briefly & Pulse spin. 5. 6. 7. Add 22 µl Master Mix to each designated reaction tube or sample wells. Add 3 µl of sample template to two designated reaction tubes or sample wells.
Close reaction tubes or seal sample plate once sample and appropriate controls have been added, briefly spin to mix bring down reagents. Instrument Set-up 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. Open AB Software (version 2.0-2.3). Fill out the “Experiment Name” field. Select 7500 (FAST).
Select “Quantitation Standard Curve” Select “TaqMan Reagents” Select “Standard (~3 hours to complete run)” Click “Plate Set Up” Under the “Define Targets” area click on the “Add New Target” until you have 2 targets. Fill Target 1 with CEA, Target 2 with IAC. Change the reporter dye to Cy5 for CEA and TexRd for IAC (do not change quenchers from the default NFQ- MGB). Under Sample section click “Add Samples” until you have the requisite number of samples. Fill in your sample name in each of the areas provided. Click “Assign Targets & Samples” tab and name samples and assign samples to the appropriate well(s). Select FAM as the passive reference dye.
Select “Run Method” The first holding stage is 3000 sec (50 min) at 50 °C. 17. The second holding stage is 900 sec (15 min) at 95 °C. 38 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. Cycling stage repeats 50 cycles. First stage 10 sec at 95 °C. Second stage 25 sec at 54 °C. Third stage set at 60 sec (1 min) at 64 °C (click the icon for collecting data at “collect data on hold”). Save the run method – Save as CEA Multiplex. Click the “Analysis” tab on the right. In the upper right corner click on “Analysis Settings” For “Data Analysis change settings Use Default Settings” , “Automatic Threshold” and “Automatic Baseline” settings. Click “Run” tab on the right. Click green “Start Run” box. Data Interpretation - Control Exclusion Assay 1. Any sample CEA RT-qPCR assay which negative for Cy5 (0 Ct value) and all controls are satisfactory, the virus detected in the HAV RT-qPCR assay was not the laboratory strain.
Note: If there was inhibition in the HAV RT-qPCR, this will be reflected in the internal amplification control for this assay also.
2. 3. Any sample CEA RT-qPCR reaction which is positive for Cy5 and all controls are satisfactory will be considered a ‘cannot rule out’ and will require gel analysis with 3% agarose or genetic bioanalyzer for confirmation of the presence or absence of the wild type strain. See Appendix F. If the RT-qPCR negative control demonstrates positive Ct results for HAV in Cy5, if the RT-qPCR positive control is negative (no Ct from Cy5) for HAV, or if the IAC is negative (no Ct from TxRed) the results are invalid; repeat assay due to nvalid results. Tables 39 Table B3.1. Primer and Probe Sequences for HAV CEA Identificatio n Primers
HAVCROF 5’ CCGTTTGCCTAGGCTATAGGCT 3’ Location ∞ JWCROR 45-66 5’- GGA GAG CCC TGG AAG AAA GAA GA -3’ IC46F 202-225 5’GAC ATC GAT ATG GGT GCC G-3’ IC194R N/A 5’-AAT ATT CGC GAG ACG ATG CAG-3’ N/A Probes
JWCROP Cy5 (TAO)-TGATTTGTAAATATTGATTCCTGCAG IB-RQ IACP 122-147 TxR –TCT CAT GCG TCT CCC TGG TGA ATG TG -IB RQ ∞based on GenBank accession # M59808 N/A 40

Table B3.2. Amplification Reaction Components
Reagent Initial Concentratio n Volume per 25 µl reaction Final Concentratio n RNase Free H20 8.425 µl
5X OneStep RT-PCR Buffer 5X 5.0 µl 1X *MgCl2 25 mM 3 µl 1.5 mM dNTP Mix 10 mM 0.75 µl 0.3 mM
CROF 10 µM 0.1875 µl 0.075 µM JWCROR 10 µM 0.1875 µl 0.075 µM IC 46Fb,c 10 µM 0.1875 µl 0.075 µM IC 194Rb,c 10 µM 0.1875 µl 0.075 µM JWCRO Probe 10 µM 0.25 µl 0.1 µM IAC Probe 10 µM 0.375 µl 0.15 µM FAM Ref Dye 500 nM 2 µl 0.04 µM Superase·in 5 Units/µl 0.25 µl 1.25 Units Enzyme Mix 1.00 µl
Internal Control RNA∞ 0.2 µl
Template 3 µlβ
*for 50 mM concentration this will be 1.5 µl per reaction and 11.925 H2O bInternal Amplification Control (IAC) primers and probes are covered by U.S. Patent Application 0060166232 cDepaola, Jones, Woods, et al. 2010.

βIf the 1 µl template was used due to inhibition, the same template volume will be used for this assay. The volume of H2O will be 10.425 per reaction.

Section B4: RT-qPCR Detection of Norovirus GI and GII Assay on the AB 7500 Platform

RT-qPCR Assay Outlined Norovirus RT-qPCR for detection of norovirus GI and GII AB 7500 (Primers, probes, and master mix preparation are found in Tables B4.1 and B4.2).
Sample Preparation - Norovirus Thermal Cycling Protocol
Reverse transcription: 50 °C for 3000 sec (50 min) Polymerase activation: 95 °C for 900 sec (15 min) 50 cycles of: 95 °C for 10 sec, 53 °C for 25 sec, 62 °C for 70 sec with optics on Reaction Set-Up
Note: Always use aerosol resistant pipette tips for PCR. 1. 2. 3. Thaw primer solutions, probe solutions, and buffer mix and place them in 4 °C bench top cool block or on ice in master mix set up hood. Vortex reagents for 2-3 sec at setting 7-10, and then briefly centrifuge for 3-5 sec in a mini-centrifuge to settle the liquid to the bottom of the tube. Place in ice or bench top cooler. Keep Enzyme Mix in cooling block or on ice at all times, these enzymes should not be defrosted.
Prepare Master Mix for all sample and control reactions as listed in table B2.1 (additional master mix preparations can be found in Appendix G). Keep all thawed components, reagents, controls and master mixes in cooling block or on ice. Note: Viral RNA templates should be added to reaction tubes in a designated area separate from location where master mixes are prepared. A negative and positive control should be added to each run set-up.
6. Proceed to hood/area or room where the template is added and thaw IAC RNA and sample RNA in the designated hood where the template is added. Briefly centrifuge the tubes 3-5 sec in micro-centrifuge to settle the liquid at the bottom of the tube. Add appropriate volume of IAC, (0.2 µl/rxn) to Master Mix (keep cold); Vortex briefly & Pulse spin. 7. Add 22 µl Master Mix to each designated reaction tube or sample wells. 42 8. 9. Add 3 µl of sample template to three designated reaction tubes or sample wells.
Seal sample plate once sample and appropriate controls have been added, briefly spin to mix bring down reagents. Instrument Set-up 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. Open AB Software (version 2.0-2.3). Fill out the “Experiment Name” field.
Select 7500 (FAST).
Select “Quantitation Standard Curve” Select “TaqMan Reagents” Select “Standard (~3 hours to complete run)” Click “Plate Set Up” Under the “Define Targets” area click on the “Add New Target” until you have 2 targets. Fill Target 1 with NoV GI, fill target 2 with NoV GII and fill Target 3 with IAC. Change the reporter dye to Cy5 for NoV GI, Cy3 for NoV GII, and TexRd for IAC (do not change quenchers from the default NFQ- MGB). Under Sample section click “Add Samples” until you have the requisite number of samples. Fill in your sample name in each of the areas provided. Click “Assign Targets & Samples” tab and name samples and assign samples to the appropriate well(s). Select FAM as the passive reference dye.
Select “Run Method” The first holding stage is 3000 sec (50 min) at 50 °C. The second holding stage is 900 sec (15 min) at 95 °C. Cycling stage repeats 50 cycles. 19. First stage 10 sec at 95 °C. 43 20. 21. 22. 23. 24. 25. 26. 27. 28. Second stage 25 sec at 53 °C. Third stage set at 70 sec (1 minute 10 sec) at 62 °C (click the icon for collecting data at “collect data on hold”). Save the run method – Save as Norovirus Multiplex. Click the “Analysis” tab on the right. In the upper right corner click on “Analysis Settings” For “Data Analysis change settings for Cy5 (NoV GI) and TexRd (Internal Control) set threshold set to 0.1, for Cy3 (NoV GII) set threshold to 0.01. Set “Baseline Start Cycle” to 3 and “End Cycle” to 10. Click “Apply Analysis Settings” Click “Run” tab on the right. Click green “Start Run” box. Data Interpretation - Norovirus Multiplex Assay For this NoV multiplex assay, Cy5 is the GI probe fluorescent label, Cy3 is the GII probe fluorescent label, and that Texas Red (TxR) is the internal amplification control (IAC) probe fluorescent label. 2. 3. Sample is “negative" if:
a. b. c. d. e. RT-qPCR negative control is negative for GI and GII,
RT-qPCR positive control is positive for GI and GII,
Matrix control sample (if included) is negative for GI and GII,
Unknown is negative for GI and GII,
Internal amplification control (IAC) is positive. No further analysis is needed. Sample is “positive” if: a. b. RT-qPCR negative control is negative for GI and GII,
RT-qPCR positive control is positive for GI and GII,
c. Unknown sample is positive for GI and/or GII. 44 4. Samples are invalid if: a. b. c. If the negative RT-qPCR control sample demonstrates positive results crossing the Cy5 or Cy3 threshold or if the IAC is negative, repeat the RT qPCR assay, The RT-qPCR positive control is negative for GI and/or GII, The average of the IAC Ct values for the sample replicates are more than 4.0 Cts greater than the Negative Control IAC Ct value, repeat the RT qPCR assay using remaining RNA or RNA from a newly extracted saved tube with a 1 µl RT-qPCR reaction in triplicate. If the repeat of the newly extracted sample yields average IAC Ct values 4.0 Ct ‘s higher than the Negative Control IAC Ct value, repeat the sample analysis from the beginning using additional food sample. With the new repeat, the concentrates will be split into 5 tubes and complete RT-qPCR with 1µl reactions in triplicate.
Note: A positive sample is a result that demonstrates log amplification. Log amplification can be viewed as a graph on the ABI 7500 Fast platform. If the sample does not exhibit log amplification and crosses the threshold, the RTqPCR reaction should be repeated. Tables 45 Table B4.1. Primer and Probe Sequences for Norovirus and Internal Amplification Control RNA
Identification Primers
Location∞ COG1Ra,∞ 5’ CTT AGA CGC CAT CAT CAT TYA C 3’
COG2Ra,β 5350-5371 5’ TCG ACG CCA TCT TCA TTC ACA 3’ COG1Fa,∞ 5080-5100 5’ CGY TGG ATG CGN TTY CAT GA 3’
COG2Fa,β 5287-5306 5’ CAR GAR BCN ATG TTY AGR TGG ATG AG 3’ IC46Fb,c 5003-5028 5’GAC ATC GAT ATG GGT GCC G-3’ IC194Rb,c N/A 5’-AAT ATT CGC GAG ACG ATG CAG-3’ N/A Probes
COGPa,∞ Cy5- 5’ (TAO) AGA TYG CGA TCY CCT GTC CA 3’ IB-RQ COGP1ba,∞ 5317-5336 Cy5- 5’ (TAO) AGA TCG CGG TCT CCT GTC CA 3’ IB-RQ COG2Pa,β 5317-5336 Cy3- 5’ TGG GAG GGC GAT CGC AAT CT 3’ -IB-RQ IACPb,c 5048-5067 TxR –TCT CAT GCG TCT CCC TGG TGA ATG TG -IB RQ* aKageyama et al., 2003, b N/A Internal Amplification Control (IAC) primers and probes are covered by U.S. Patent Application 0060166232 cDepaola, Jones, Woods, et al. 2010. ∞Based on GenBank accession # KF039728 βBased on GenBank accession # EF684915 *IB RQ- Iowa Black RQ 46

Table B4.2. ABI 7500 Amplification Reaction Components for Norovirus Reagent Initial Concentratio n Volume per 25 µl reaction Final Concentratio n RNase Free H20 7.3 µl - 5X OneStep RT-PCR Buffer 5X 5.0 µl 1X MgCl2~ 50 mM 0.75 µl 1.5 mM dNTP Mix 10 mM 1 µl 0.4 mM
COG1F 10 µM 0.75 µl 0.3 µM COG1R 10 µM 0.75 µl 0.3 µM COG2F 10 µM 0.75 µl 0.3 µM COG2R 10 µM 0.75 µl 0.3 µM IC 46F 10 µM 0.1875 µl 0.075 µM IC 194R 10 µM 0.1875 µl 0.075 µM COG1P 10 µM 0.25 µl 0.1 µM COG1Pb 10 µM 0.25 µl 0.1 µM COG2P 10 µM 0.25 µl 0.1 µM IACP 10 µM 0.375 µl 0.15 µM OneStep RT-PCR Enzyme Mix 1.00 µl
Superase·in 20 Units/µl 0.25 µl 5 Units FAM ref dye 500 nM 2 µl 0.04 µM Internal Amplification Control RNA *0.2 µl -

RNA 3 µl
*Amount varies with concentration of IAC RNA. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold (Ct) of 20-25 when no inhibition is present in the reaction. The required concentration was provided to each laboratory participating in the validation study.

˜With the addition of 1.5 mM MgCl, the final concentration per reaction is 4.0 mM MgCl.

Section B5: RT-qPCR Detection of Mengovirus on ABI 7500 Platforms

RT-qPCR Assays
Outlined Mengovirus RT-qPCR Assay for AB 7500 (Primers, probes, and master mix preparation are found in Table B5.1 and B5.2.
Sample Preparation – Mengovirus Reverse transcription: 50 °C for 3000 sec (50 min) Polymerase activation: 95 °C for 900 sec (15 min) Cycling: 45 cycles of 95 °C for 10 sec, 50 °C for 25 sec, 62 °C for 60 sec with optics on Reaction Set-Up *Note: Always use aerosol resistant pipette tips for PCR. 1. 2. 3. Thaw primer solutions, probe solutions, and buffer mix and place them in 4 °C bench top cool block or on ice in master mix set up hood. Vortex reagents for 2-3 sec at setting 7-10, and then briefly centrifuge for 3-5 sec in a mini-centrifuge to settle the liquid to the bottom of the tube. Place in ice or bench top cooler. Keep Enzyme Mix in cooling block or on ice at all times, these enzymes should not be defrosted.
Prepare Master Mix for all sample and control reactions as listed in table B5.1 (additional master mix preparations can be found in Appendix H). Keep all thawed components, reagents, controls and master mixes in cooling block or on ice. Note: Viral RNA templates should be added to reaction tubes in a designated area separate from location where master mixes are prepared. A negative and positive control should be added to each run set-up.
4. 5. Proceed to hood/area or room where the template is added and thaw IAC RNA and sample RNA in the designated hood where the template is added. Briefly centrifuge the tubes 3-5 sec in micro-centrifuge to settle the liquid at the bottom of the tube. Add appropriate volume of IAC, (0.2 µl/rxn) to Master Mix (keep cold); Vortex briefly & Pulse spin. Add 22 µl Master Mix to each designated reaction tube or sample wells. 6. Add 3 µl of sample template to three designated reaction tubes or sample wells.
48 7. Close reaction tubes or seal sample plate once sample and appropriate controls have been added, briefly spin to mix bring down reagents. Instrument Set-up 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. Open AB Software (version 2.0-2.3). Fill out the “Experiment Name” field.
Select 7500 (FAST).
Select “Quantitation Standard Curve” Select “TaqMan Reagents” Select “Standard (~3 hours to complete run)” Click “Plate Set Up” Under the “Define Targets” area click on the “Add New Target” until you have 2 targets. Fill Target 1 with Mengovirus, Target 2 with IAC. Change the reporter dye to Cy5 for Mengovirus and TexRd for IAC (do not change quenchers from the default NFQ- MGB). Under Sample section click “Add Samples” until you have the requisite number of samples. Fill in your sample name in each of the areas provided. Click “Assign Targets & Samples” tab and name samples and assign samples to the appropriate well(s). Select FAM as the passive reference dye.
Select “Run Method” The first holding stage is 3000 sec (50 min) at 50 °C. The second holding stage is 900 sec (15 min) at 95 °C. Cycling stage repeats 45 cycles. First stage 10 sec at 95 °C. 20. Second stage 25 sec at 50 °C.
49 21. 22. 23. 24. 25. 26. 27. 28. Third stage set at 60 sec (1 min) at 62 °C (click the icon for collecting data at “collect data on hold”). Save the run method – Save as Mengovirus Multiplex. Click the “Analysis” tab on the right. In the upper right corner click on “Analysis Settings” For “Data Analysis change settings for Cy5 (Mengovirus) and TexRd (Internal Control): Threshold set to 0.1 and “Baseline Start Cycle” to 3 and “End Cycle” to 10. Click “Apply Analysis Settings” Click “Run” tab on the right. Click green “Start Run” box. Data Interpretation - Mengovirus Assay For this Mengovirus multiplex assay, Cy5 is the Mengovirus probe fluorescent label and Texas Red (TxR) is the internal amplification control (IAC) probe fluorescent label. 1. Repeat any “invalid” samples. Sample is “invalid” if: a. b. c. d. The negative RT-qPCR control sample demonstrates positive results crossing the Cy5 or if the IAC is negative, The RT-qPCR positive control is negative for Mengovirus, The Mengovirus RT-qPCR is negative in any sample, The average of the IAC Ct values for the sample replicates are more than 4.0 Cts greater than the Negative Control IAC Ct value, repeat the RT- qPCR assay using remaining RNA or RNA from a newly extracted tube with a 1 µl template in the RT-qPCR reaction in triplicate. If the 1 µl template reactions yields an average IAC Ct values greater than 4.0 Ct higher than the Negative Control IAC Ct value, repeat the sample analysis from the beginning using additional food sample. With the new sample, the concentrates will be split into 5 tubes and complete RT-qPCR with 1 µl reactions in triplicate. 2. Sample is “valid” and can be reported if: 50 a. b. c. d. RT-qPCR negative control is negative for Mengovirus, RT-qPCR positive control is positive for Mengovirus, RT-qPCR is positive for Mengovirus in all spikes matrices, Internal amplification control (IAC) is positive in all reactions and average of the IAC Ct values for sample is within 4.0 Cts of the Negative Control IAC Ct Value. Note: For mengovirus, if the average of the IAC Ct values for the sample replicates are more than 4.0 Cts greater than the negative control IAC Ct value AND the corresponding sample is positive for norovirus and/or hepatitis A virus, the Mengovirus RTqPCR does not have to be repeated. If norovirus or hepatitis A virus is detected in a sample that has inhibition present in the RTqPCR reaction and has log amplification, this sample does not need to be repeated for norovirus or hepatitis A virus RTqPCR and would be considered positive. Repeating RT-qPCR reactions due to inhibition is to ensure that you do not have false negatives.
Tables 51 Table B5.1. Primer and Probe Sequences for Mengovirus and Internal Amplification Control RNA
Identification Primers
Location∞ MengoFa, β 5’ GCG GGT CCT GCC GAA AGT 3’
MengoRa,β 110-127 5’ GAA GTA ACA TAT AGA CAG ACG CAC AC 3’ IC46Fb,c 239-264 5’GAC ATC GAT ATG GGT GCC G-3’ IC194Rb,c N/A 5’-AAT ATT CGC GAG ACG ATG CAG-3’ N/A Probes
MengoPa, β Cy5- 5’ ATC ACA TTA CTG GCC GAA GC 3’ -IB-RQ 203-221 IACPb,c TxR –TCT CAT GCG TCT CCC TGG TGA ATG TG -IB RQ aPinto et. al 2009 et al. b N/A Internal Amplification Control (IAC) primers and probes are covered by U.S. Patent Application 0060166232 cDepaola, Jones, Woods, et al. 2010. βBased on GenBank accession # DQ2946335 *IB RQ- Iowa Black RQ 52

Table B5.2. ABI 7500 Amplification Reaction Components and Master Mix Volume for Mengovirus Reagent Initial Concentration Volume per 25 µl reaction Final Concentration RNase Free H20 9.425 µl - 5X OneStep RT-PCR Buffer 5X 5.0 µl 1X MgCl2 50 mM 0.75 µl 1.5 mM dNTP Mix 10 mM 1 µl 0.4 mM MengoF 10 µM 0.50 µl 0.2 µM MengoR 10 µM 0.50 µl 0.2 µM IC 46F 10 µM 0.1875 µl 0.075 µM IC 194R 10 µM 0.1875 µl 0.075 µM Mengo Probe 10 µM 0.625 µl 0.25 µM IACP 10 µM 0.375 µl 0.15 µM OneStep RT- qPCR Enzyme Mix 1.00 µl
Superasin 20 Units/µl 0.25 µl 5 Units FAM ref dye 500 nM 2 µl 0.04 µM Internal Amplification Control RNA *0.2 µl -

RNA/Extract 3µl
*Amount varies with concentration of IAC RNA. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold (Ct) of 20-25 when no inhibition is present in the reaction. The required concentration was provided to each laboratory participating in the validation study.

˜With the addition of 1.5 mM MgCl2 the final concentration per reaction is 4.0 mM MgCl2

Section B6: Buffer and Recipes

1. Working Concentration FAM Dye
FAM dye (BioRAD)
0.5 µl
Primer TE
1000 µl

Add mixture to 1.5 ml DNase/RNase free dark tube, mix well and make 250 µl aliquots in DNase/RNase dark tubes. Store at 4 °C for 3 months.

2. Primer TE (10 mM Tris, 0.1 mM EDTA, pH 8.0)
1 M Tris pH 8.0
100 ul
0.05 M EDTA
20 ul
PCR-grade water (Dnase/Rnase free)
9.88 ml

Prepare in sterile 50 ml conical tube. Store at room temperature.

3. 1X TAE buffer
50X TAE
100 ml
DI Water
4900 ml

Combine and mix well before use.

Section B7: Positive Controls Preparation

Sample positive control preparation from propagated or commercially acquired virus (murine norovirus, mengovirus, hepatitis A virus).
  1. For murine norovirus and mengovirus, obtain 1 aliquot of the diluted extraction control as prepared in section A5. For hepatitis A virus, prepare as indicated for the extraction controls.
  2. Follow manufactures instruction for QIAamp Viral RNA Mini Kit or RNesay kit for extraction of RNA.
  3. For norovirus GI and GII transcripts, prepare according to manufacturer’s instructions.
  4. Add Superasin to extraction RNA for a final concentration of 1%. Aliquot for use as your PCR positive control working stock. Store positive control at ≤ -20 °C for short term (≤ 30 days) and -70 °C for long term.

Recommended Ct for all positive controls is ≤ 35.