An updated Method, Chapter 19B: Detection of Cyclospora cayetanensis in Fresh Produce using real-time PCR, is available below.
Terminology
?
Overview
?
Chapter 19a
Wash Procedure for Fresh Produce
This procedure can be used to analyze for potential contaminants on fresh leafy produce (lettuce, herbs, etc) and berries (e.g. raspberries) and may be applicable to other fresh produce.
- Place produce to be analyzed (10-25 g of fresh leafy produce or 50g of fresh berries) in a BagPage®+ filter bag, add 100 ml dH2O and seal with Bag Clip.
- Place on rocker platform and gently agitate for 30 minutes at room temperature, inverting the bag after 15 minutes.
- Decant supernatant from the BagPage®+ filter bag into clean 50 ml conical centrifuge tubes and centrifuge for 20 minutes at 2,000xg.
Isolation of Cyclospora from Fresh Produce Washes
- Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 45 ml when combined.
- Suspend pellets in remaining supernatants and combine.
- Add 2.5 ml 20% (w/v) celite in NET-BSA suspension (ensure that celite is thoroughly suspended prior to its addition to sample washes). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Add 1.0 ml of 10% PVPP suspension (w/v). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Prepare a 150 ml analytical filter unit by removing the membrane filter (0.45 µm or 0.2 µm) but retaining the grade 4 filter backing. Attach to a vacuum source.
- Pre-wet the analytical filter with a small volume (~10ml) of NET buffer.
- Decant celite/PVPP-containing sample wash into a prepared 150 ml analytical filter unit and vacuum filter. Ensure that the liquid passes through the filter septum to remove particulates and the celite particles from the suspension as it is filtered. The adsorbant celite should prevent filter clogging.
- Rinse the container with 10 ml NET to recover as much of the residual celite-containing sample and decant into the filter unit. Then rinse the celite and particulate material trap onto the filter with an additional 10 ml volume of NET.
- Prior to FTA filtration in step 4l, save ~10% of the filtered sample for microscopic examination.
- Prepare filter funnel unit(s) containing FTA filter disk and attach to vacuum manifold.
- Under vacuum, pre-wet the FTA filter assembly.
- Slowly decant filtrate from step 4i into filter funnel unit while under vacuum until entire sample has passed through FTA filter.
- In succession while filter funnel unit is still attached to vacuum manifold, rinse filter twice with 10 ml of FTA purification buffer and twice with 10 ml of FTA filter wash buffer.
- Remove filter funnel unit from vacuum manifold, disassemble unit and dry FTA filter disk on 56°C heating block.
Isolation of Cryptosporidium spp. from Fresh Produce Washes
- Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 10 ml when combined.
- Suspend pellets in remaining supernatants and combine. NOTE: pellet volume should not exceed 0.5 ml packed volume as it will interfere with subsequent steps that employ immunomagnetic adsorption of Cryptosporidium oocysts.
- Follow directions accompanying Dynabead anti-Cryptosporidium Kit for immunomagnetic separation (IMS) of Cryptosporidium oocysts from fresh produce washes using recommend tubes and magnetic capturing devices.
- Elute captured Cryptosporidium oocysts in a 0.1 ml volume of 0.1N HCl for 5 minutes a room temperature.
- Neutralize acid eluates with 0.01 ml 1N NaOH. Save ~10% of the sample for microscopic examination.
- Dilute with 10 ml NET buffer.
- Proceed as in Section 4A, steps j-n.
Isolation of Parasitic Contaminants from Juices, Cider and Milk
This procedure can be used to analyze for contaminants in liquid samples such as orange juice, apple juice, apple cider, milk and milk products.
Isolation of Cyclospora from Juices, Cider and Milk
- Adjust a 25 ml aliquot of liquid sample to pH 8.0.
- Add an equal volume of NET buffer and mix well.
- Proceed as in Section 4A, steps c-n
Isolation of Cryptosporidium spp. from Juices, Cider and Milk
A 10 ml volume of cider, juice or milk product is directly sampled by IMS using the Dynabead anti-Cryptosporidium Kit along with the recommend tubes and magnetic capturing devices as in Section 4B, steps c-f.
Isolation of Parasitic Contaminants from Large Volumes of Water
This procedure is designed to isolate contaminants from a designated water source (stream, river, reservoir, standing water, runoff, etc).
- Place a single Envirochek™ sampling capsule in line with the water source to be sampled. Ensure that the flow rate does not exceed the standards established by the manufacturer.
- Collect a water sample from 10 L of flow through.
- Remove contaminants captured by the filter using 125 ml of elution buffer. Filters should be treated with elution buffer, sealed and agitated on a rotating wheel (moderate speed) for at least 5-10 minutes following the manufacturer's recommendations. Decant filter rinse into a 250 ml conical centrifuge tube.
- Repeat step 6c and combine filter rinses.
- Centrifuge the sample at 1,500-2,000 x g for 20 minutes allowing the centrifuge to coast to a stop (do not use the brake)
- Proceed as described in Sections 4A and 4B for the isolation of Cyclospora and Cryptosporidium spp. respectively.
Slide Preparation and Microscopic Analysis – Cyclospora cayetanensis
Cyclospora oocysts emit a cobalt blue autofluorescence with the UV-1A emission filter or blue green with broader emission spectra filters under ultraviolet illumination. Prepare slides in duplicate and examine slides under ultraviolet illumination as described below.
Laboratories should use a microscope reticle capable of measuring organism in the 8-10 µm range to verify oocyst size when organisms are recovered. Compare morphological characteristics of presumptive oocysts to those in a known standard.
Slide Preparation
Centrifuge the volume set aside for microscopic analysis (Section 4A, step i), at 1,500 × g for 10-15 min at 4°C. Aspirate supernatant to within 0.5 ml of debris pellet. Uniformly suspend pellet material by gentle, repeated pipetting.
- Apply silicone vacuum grease to edge of cover slip
- Place 10 µl of suspended debris to a clean glass microscope slide and prepare a wet mount using pre-greased cover slip
Microscopy
- Examine slide under UV light at 400× magnification. Cyclospora oocysts autofluoresce cobalt blue. Examine slide at multiple planes under UV. Occasionally, debris in slide preparations make it difficult to only view the slide on one plane.
- Switch from epifluorescence microscopy to bright field microscopy or differential interference contrast microscopy. Determine oocyst size of any presumptive oocysts at 1000X magnification. Compare to standards. Confirm internal structures of presumptive Cyclospora oocysts as compared to a standard.
- Seal cover slips to the glass slides of presumptive positives with fingernail polish, slide compound or paraffin wax.
- Document presumed positive samples with photographs taken at multiple planes.
Slide Preparation and Microscopic Analysis & Cryptosporidium spp.
Microscopic examination of produce washings and other liquid samples for the presence of Cryptosporidium spp. oocysts will be conducted using commercially available immuno magnetic bead separation (IMS) kits and immunofluorescence labeling kits.
- An aliquot (~10µl) of the IMS-derived sample Section 4B, step e, is FITC-labeled using the Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Ensys Inc., Research Triangle Park, NC) per the manufacturer's instructions and examined in conventional DIC and epifluorescence mode.
| Excitation Filter | Dichroic Filter | Barrier Filter | Red Suppression Filter |
|---|---|---|---|
| KP500 | TK510 | K510 or K530 | BG38 |
| FITC | TK510 | K530 | BG38 |
| D. Tungsten-Halogen 50 and 100 W | |||
| KP500 | TK510 | K510 or K530 | BG38 |
| FITC | TK510 | K530 | BG38 |
PCR Analysis
The molecular detection of Cyclospora spp. and Cryptosporidium spp. is independently accomplished using nested PCR protocols. The differential identification of Cyclospora cayetanensis from other closely related non-human pathogenic parasites (i.e. Eimeria spp.) employs a nested multiplex PCR assay. This assay can be accomplished using either a conventional thermal cycler with heated lid or a real-time PCR platform using the Roche LightCycler®.
The detection of Cryptosporidium spp. also involves nested PCR amplification. However, differentiation and speciation of Cryptosporidium spp. requires further analysis by a restriction fragment length polymorphism (RFLP) assay. Please note the following: C. parvum genotype I has been renamed C. hominis; C. parvum genotype II (bovine strain) is now referred to as C. parvum
A. DNA Primers
| Primer Designation | Primer Specificity | Primer Sequence (5'→3') | Amplicon Size (bp) | Designated Application |
|---|---|---|---|---|
| F1E (forward) | Cyclospora and Eimeria spp. | TACCCAATGAAAACAGTTT | 636 | Primary Amplification |
| R2B (reverse) | Cyclospora and Eimeria spp. | CAGGAGAAGCCAAGGTAGG | 636 | Primary Amplification |
| CC719 (forward) | C. cayetanensis | GTAGCCTTCCGCGCTTCG | 298 | Nested Amplification |
| PLDC661 (forward) | C. cercopitheci, C. colobi, C. papionis | CTGTCGTGGTCATCGTCCGC | 361 | Nested Amplification |
| ESSP841 (forward) | Eimeria spp. | GTTCTATTTTGTTGGTTTCTAGGACCA | 174 | Nested Amplification |
| CRP999 (reverse) | Cyclospora and Eimeria spp. | CGTCTTCAAACCCCCTACTGTCG | — | Nested Amplification |
| Primer Designation | Primer Specificity | Primer Sequence (5'→3') | Amplicon Size (bp) | Designated Application |
|---|---|---|---|---|
| ExCry1 (forward) | Cryptosporidium spp. | GCCAGTAGTCATATGCTTGTCTC | 844 | Primary Amplification |
| ExCry2 (reverse) | Cryptosporidium spp. | ACTGTTAAATAGAAATGCCCCC | 844 | Primary Amplification |
| NesCry3 (forward) | Cryptosporidium spp. | GCGAAAAAACTCGACTTTATGGAAGGG | 590–593 | Nested Amplification |
| NesCry4 (reverse) | Cryptosporidium spp. | GGAGTATTCAAGGCATATGCCTGC | 590–593 | Nested Amplification |
B. General Sample Preparations for Primary PCR Amplifications
- a.
- Punch marked triplicate areas (6 mm diameter) from dried FTA filter disk using a single punch hole-puncher.
- Decontamination of the hole-puncher is not necessary as cross contamination between samples from the hole-puncher has been found to be negligible.
- However, the individual researcher may wish to swab the punch with ethanol between sample disks if it is deemed appropriate.
- b.
- Insert filter punches snuggly into bottom of 0.65 ml thin-walled PCR tubes.
- c.
- Dispense 50 µl HotStartTaq™ Master Mix into each PCR tube.
- d.
- Prepare reagent master mix (see Table 4) with the appropriate forward and reverse DNA primers (see Tables 2 and 3) and dispense into each PCR tube.
- e.
- All PCR analyses must include positive and negative controls (see Table 5).
- f.
- Mix tubes with gentle tapping.
- g.
- Follow the appropriate thermal cycling protocol (Table 6 and 7) for primary PCR amplification.
| Component | Volume (µl) | Final Concentration |
|---|---|---|
| FTA Filter Disk (DNA Template) | — | — |
| HotStartTaq™ Master Mix | 50.0 | † |
| MgCl₂ (25 mM) | 2.0 | 2.0 mM‡ |
| Forward Primer (10 µM) | 2.0 | 0.2 µM |
| Reverse Primer (10 µM) | 2.0 | 0.2 µM |
| Sterile deionized water | 44.0 | — |
| Total Volume | 100.0 | — |
| Control Type | Condition / Organism |
|---|---|
| Negative Control-1 | Reagent blank — no filter |
| Negative Control-2 | Reagent blank + unspotted, washed filter |
| Positive Control | Cyclospora cayetanensis |
| Positive Control | Cyclospora spp. (NHP) |
| Positive Control | Eimeria spp. |
| Positive Control | C. hominis (formerly C. parvum genotype I) |
| Positive Control | C. parvum (formerly genotype II, bovine) |
| Positive Control | C. baileyi |
| Positive Control | C. serpentis |
| Step | Number of Cycles | Temperature and Time |
|---|---|---|
| Primary PCR Initial Activation | 1 | 95°C; 15 min |
| Amplification (Denaturation) | 35 | 94°C; 30 sec |
| Amplification (Annealing) | 35 | 53°C; 30 sec |
| Amplification (Extension) | 35 | 72°C; 90 sec |
| Final Extension | 1 | 72°C; 10 min |
| Nested Multiplex Initial Activation | 1 | 95°C; 15 min |
| Amplification (Denaturation) | 25 | 94°C; 15 sec |
| Amplification (Annealing/Extension) | 25 | 66°C; 15 sec |
| Step | Number of Cycles | Temperature and Time |
|---|---|---|
| Primary PCR Initial Activation | 1 | 95°C; 15 min |
| Amplification (Denaturation) | 40 | 94°C; 45 sec |
| Amplification (Annealing) | 40 | 53°C; 75 sec |
| Amplification (Extension) | 40 | 72°C; 45 sec |
| Final Extension | 1 | 72°C; 7 min |
| Nested PCR Initial Activation | 1 | 95°C; 15 min |
| Amplification (Denaturation) | 35 | 94°C; 25 sec |
| Amplification (Annealing) | 35 | 65°C; 25 sec |
| Amplification (Extension) | 35 | 72°C; 25 sec |
| Final Extension | 1 | 72°C; 7 min |
Conventional Nested Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
- Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (Table 8) and dispense into all tubes
- Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol listed in Table 6.
| Component | Volume (µl) | Final Concentration |
|---|---|---|
| HotStartTaq™ Master Mix | 25.0 | † |
| MgCl₂ (25 mM) | 1.0 | 2.0 mM‡ |
| CC719 (forward primer, 10 µM) | 1.0 | 0.2 µM |
| PLDC661 (forward primer, 10 µM) | 1.0 | 0.2 µM |
| ESSP841 (forward primer, 10 µM) | 1.0 | 0.2 µM |
| CRP999 (reverse primer, 10 µM) | 1.0 | 0.2 µM |
| Sterile deionized water | 19.0 | — |
| DNA Template (primary amplicon) | 1.0 | — |
| Total Volume | 50.0 | — |
OPTIONAL-Real Time Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp. using the Roche LightCycler® System
- a.
- Place the requisite number of glass capillaries in a pre-chilled cooling block (with accompanying centrifuge adapters)
- b.
- Prepare a reagent master mix (Table 9) and dispense into individual 0.65 ml PCR tubes
- c.
- Complete reaction samples with the addition of the 1 µl of primary amplicon solution.
- d.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- e.
- Mix tubes with gentle tapping.
- f.
- Dispense reaction mixture into glass capillaries, cap, and centrifuge briefly (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
- g.
- Transfer glass capillaries to LightCycler® carousel.
- h.
- Follow the appropriate thermal cycling protocol for (Table 10 ).
- i.
- Real time confirmation of pathogen can be made by melting curve analyis (see Table 11)
- j.
- For final confirmation, samples can be recovered from each glass capillary.
- k.
- Uncap, invervet capillary into a 0.65 ml PCR tube containing 5 µl of gel loading solution, and briefly centrifuge (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
- l.
- Following instruction for agarose gel electrophoresis (Part 9, Section F, steps b-f)
| Component | Volume (µl) | Final Concentration |
|---|---|---|
| LightCycler®-FastStart DNA Master SYBR Green | 2.0 | — |
| MgCl₂ (25 mM) | 1.6 | 3.0 mM |
| CC719 (forward primer, 10 µM) | 1.0 | 0.5 µM |
| PDCL661 (forward primer, 10 µM) | 1.0 | 0.5 µM |
| ESSP841 (forward primer, 10 µM) | 1.0 | 0.5 µM |
| CRP999 (reverse primer, 10 µM) | 1.0 | 0.5 µM |
| Sterile deionized water | 11.4 | — |
| DNA Template (primary amplicon) | 1.0 | — |
| Total Volume | 20.0 | — |
| Step | Number of Cycles | Temperature and Time | Comments |
|---|---|---|---|
| Hot Start | 1 | 95°C; 10 min | — |
| Amplification (Denaturation) | 30 | 95°C; 15 sec | — |
| Amplification (Annealing) | 30 | 66°C; 15 sec | Single Fluorescence Acquisition |
| Melting Curve Analysis | 1 | 95°C; 15 sec | — |
| Melting Curve Analysis | 1 | 65°C; 15 sec | — |
| Melting Curve Analysis | 1 | 98°C; 0.1°C/sec | Continuous Fluorescence Acquisition |
| Primer Designation | Primer Specificity | Primer Sequence (5'→3') | Amplicon Size (bp) | Amplicon Tm (°C) |
|---|---|---|---|---|
| CC719 | C. cayetanensis | GTAGCCTTCCGCGCTTCG | 298 | 85 |
| PLDC661 | C. cercopitheci, C. colobi, C. papionis | CTGTCGTGGTCATCGTCCGC | 361 | 91 |
| ESSP841 | Eimeria spp. | GTTCTATTTTGTTGGTTTCTAGGACCA | 174 | 81 |
Nested PCR Amplification for the Differential Identification of Cryptosporidium spp.
- a.
- Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
- b.
- Prepare reagent master mix (Table 12) and dispense into all tubes
- c.
- Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
- d.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- e.
- Mix tubes with gentle tapping.
- f.
- Follow the appropriate thermal cycling protocol listed in Table 7.
| Component | Volume (µl) | Final Concentration |
|---|---|---|
| HotStartTaq™ Master Mix | 25.0 | † |
| MgCl₂ (25 mM) | 1.0 | 2.0 mM‡ |
| NesCry3 (forward primer, 10 µM) | 1.0 | 0.2 µM |
| NesCry4 (reverse primer, 10 µM) | 1.0 | 0.2 µM |
| Sterile deionized water | 21.0 | — |
| DNA Template (primary amplicon) | 1.0 | — |
| Total Volume | 50.0 | — |
Agarose Gel Electrophoresis
- a.
- Mix 10 µl of nested amplification product with 2-3 µl of gel loading solution.
- b.
- Load samples into wells of a 1.5% agarose gel prepared with 0.5 x TAE containing 0.2 µg/ml ethidium bromide. Include at least one lane containing 100 bp DNA ladder to approximate the size of any amplicon present.
- c.
- Run the gel at 125 volts (constant voltage) for at least 30 min.
- d.
- PCR products on the agarose gel can be visualized by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system, if you decide to include that in the material & methods).
- e.
- The primary amplicon from primer pair F1E/R2B for Cyclospora PCR may not be visible; therefore, only product from the nested reaction should be electrophoresed.
- f.
- Predicted sizes of PCR amplicons from Cyclospora spp., Eimeria spp. and Cryptosporidium spp. are listed in Tables 1 and 2
Restriction Fragment Length Polymorphism (RFLP) Analysis of Cryptosporidium spp. Nested PCR Amplicons to Determine the Presence of C. parvum Oocysts and Distinguish C. hominis from C. parvum
- a.
- A 590 bp (genotype I) or a 593 bp product (genotype II) following nested PCR is a presumptive positive for the presence of Cryptosporidium spp.
- b.
- The restriction patterns resulting from the digestion of the nested amplicon with restriction endonucleases VspI and DraII will distinguish between C. parvum and C. hominis (VspI digestion) and C. parvum from C. baileyi and C. sepentis (DraII digestion).
- c.
- Combine 15 µl of the Cryptosporidium nested PCR amplicon with on unit VspI, 2.0 µl of 10x enzyme buffer, and 0.2 µl BSA solution (include with enzyme). Adjust final volume to 20 µl with sterile dH2O.
- d.
- For digestion with DraII, combine 15 µl of the Cryptosporidium nested PCR amplicon with one unit DraII, 2.0 µl of 10x enzyme buffer, and adjust final volume to 20 µl.
- e.
- Positive controls for C. parvum and other species of Cryptosporidium must be digested in the same manner and alongside test samples.
- f.
- Incubate digestion samples for at least 2 hr at 37°C.
- g.
- Analyze samples by gel electrophoresis using a 3% NuSieve gel prepared with 0.5x TAE and 0.2% ethidium bromide.
- h.
- Mix 10-15 µl of nested amplification product with 2-3 µl of gel loading solution and load into wells of gel. Include at least one lane containing 25 bp DNA ladder to estimate the size of restriction fragments present.
- i.
- Run the gel at 125 volts (constant voltage) for at least 45 min.
- j.
- RFLP patterns can be visualized on the agarose gel by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system).
- k.
- Predicted banding patterns confirmatory for the presence of Cryptosporidium spp. are listed in Table 13.
| Organism | Primary PCR (bp) | Nested PCR (bp) | VspI Digestion Products (bp) | DraII Digestion Products (bp) |
|---|---|---|---|---|
| C. hominis (formerly C. parvum genotype I) | 844 | 593 | 503 and 90 | — |
| C. parvum (formerly C. parvum genotype II) | 840 | 590 | — | — |
| C. baileyi | 831 | 579 | — | 295 and 284† |
| C. serpentis | 836 | 583 | — | 298 and 284† |
| C. muris | — | — | — | — |
| C. wrairii | — | — | — | — |