A. Produce Washing and DNA Extraction Procedures

A1. Laboratory Facilities

Best laboratory practices should be used to limit false positive results due to cross contamination. The following work areas are recommended to complete the produce washing and DNA extraction steps while minimizing the potential for contamination:

  1. A laboratory bench for produce washing.
  2. A hood for DNA extraction procedure.

A2. Materials and Equipment

A3. Reagents

B. Cyclospora cayetanensis Real-Time PCR Detection Method

B1. Equipment and Supplies

B2. Reagents

B3. Reagent Ordering and Preparation Instructions

All Primers, Probes, and Target control DNAs are commercially synthesized by Integrated DNA Technologies (IDT), Coralville, IA. They could also be ordered from an equivalent manufacturer based on the same specifications.

B3A. Primers

All primers are ordered from IDT normalized to a working concentration of 500 µM and stored at -20°C.

Primer Ordering Instructions
Choose "Custom DNA Oligos" from the IDT online Order Menu page.
From the "Normalization" drop down menu:
  • Choose "Create a custom formulation"
  • Choose "Full product yield, to a specified µMolar concentration"
  • Enter "500" and choose "IDTE 8.0 pH"
  • Name the normalization "500 µM" and Save.
Next, on the Oligo Entry page enter the primer options as indicated below for each primer:
Table 1. Primer Ordering Instructions

TODO

Table 2. Primer Names and Sequences

TODO

B3B. Probes

Taqman-style hydrolysis probes are used for detection of the C. cayetanensis and IAC targets. The C. cayetanensis probe is labeled with 5’ FAM reporter dye and is double quenched with an internal ZEN quencher and 3’ Iowa Black® FQ (IABkFQ) quencher. The IAC probe is labeled with 5’ Cy5 reporter dye is double quenched with an internal TAO quencher and 3’ Iowa Black® RQ-Sp (IAbRQSp) quencher. Probes are ordered from IDT and hydrated to working concentrations as described below and stored at -20° C.

Probe Ordering Instructions
Probes are ordered from the IDT online order menu page by choosing "Custom qPCR Probes"
Choose PrimeTime qPCR Probes
Choose 250 nmol or 1 µmol scale.
Enter probe nucleotide sequence and choose "5’ Dye/3’ Quencher" options as indicated for each probe in Table 3. (No "Services" options are required.)
Table 3. Probe Ordering Information

TODO

Preparation of Probe Working Solutions
100 µM Mit1P-FAM: Hydrate the lyophilized probe in sterile DNase-free TE buffer by adding the volume specified on the accompanying IDT probe specification sheet for a 100 µM final concentration. Vortex and centrifuge the hydrated probe briefly.
100 µM dd-IAC-Cy5: Hydrate the lyophilized probe in sterile DNase-free TE buffer by adding the volume specified on the accompanying IDT probe specification sheet for a 100 µM final concentration. Vortex and centrifuge the hydrated probe briefly.

B3C. IAC Target

The IAC reaction target (HMultra130-synIAC) is a synthetic 200 bp ultramer DNA sequence based on the internal amplification control developed by Deer et al., (2010).

Ordering Instructions
From the IDT online order menu page choose "Ultramer Oligos (up to 200 bases)"
On the Oligo Entry page enter or choose the following:
Table 4. Ultramer Oligo Description

TODO

Sequence
TACAGCACCCTAGCTTGGTAGAATCGATCAGCTACGTGAGGTCCTACGACGATCGCCAAGCATGCCCTAGCTAAGATGCATCGATTGCTCATCACGTACGTTAGGTCGACTAGGAGGACTGGAGTGCATCGACTAGCTAAGATGGTTCGATTGCTCATCACGAAGGTTAGGTCGACTACGAACGAGTCGTATTGCAGGTT
Preparation of IAC Target Working Solution
Hydrate the ultramer and prepare dilutions in TE pH 7.5 dilution buffer according to Appendix 3 to obtain the working concentration of 1E7 copies/µL. Store dilutions at -20° C.

B3D. Positive Control

The positive control DNA (Mit1AA gblock) is a 245 bp double stranded synthetic gBlocks® Gene Fragment synthesized by IDT or from a different supplier based on these specifications: The sequence corresponds to a region (4325 bp - 4569 bp, Genbank: KP231180.1) in the C. cayetanensis Mitochondrial gene. In addition, this sequence contains traceable mutations (T4385A and T4386A) within the amplicon generated by the real-time PCR primers used in this protocol.

Ordering Instructions

From the IDT online order menu page choose "gBlocks Gene Fragments".

Enter the following item name and sequence on the gBlocks® Gene Fragments Entry page:

Item Name
Mit1AA gblock
Sequence
ACAGTTGGTTTTCTATTTTCACCATTCTTGCTCACTGTATTAGTATTATTTAATTTTACTAATAGAGAAGTTGGTACTACATCAGCTTCTCTGGTTTCATCAATTTGTTTAGGTGTTATTAGTACTGAGTTACTACTATTTGTTAGCTTCTTCTGGGGTGCATACACCAGCATTCTATCTCCTAGTTATGTAACAGACTCCACCCTAGTAAGTCCAACTGAGGGTCTTGTAAGTATCTCTAGTAG

Click "Add to Order"

Answer "No" to all questions on the Terms and Disclosure pop up window

Type your name in the Signature box → accept the terms and conditions

Click "Add to Cart". The amount delivered will be 250 ngrams of the gBlock.

Preparation of Working Solution

Hydrate the gBlock and prepare dilutions according to Appendix 4 to obtain the working solution concentration of 5E2 copies/µL.

The positive control working solution can be stored at -20°C or 4°C.

A fresh working solution should be prepared from the frozen 5E3 dilution every 90 days.