A. Produce Washing and DNA Extraction Procedures
A1. Laboratory Facilities
Best laboratory practices should be used to limit false positive results due to cross contamination. The following work areas are recommended to complete the produce washing and DNA extraction steps while minimizing the potential for contamination:
- A laboratory bench for produce washing.
- A hood for DNA extraction procedure.
A2. Materials and Equipment
- Interscience BagPage®+ 400 mL filter bags, 500/pk, Cat No. EW-36840-56 (Cole-Parmer)
- Interscience Bag Clips, 50/pk, Cat No. EW-36850-46 (Cole-Parmer)
- Disposable serological pipets, 5 mL and 25 mL or 50 mL
- Tray to hold filter bags during washing step (see Figure 1b-c)
- Stovall Belly Dancer or comparable orbital mixing platform
- Platform rocker
- 15 mL and 50 mL conical centrifuge tubes for produce washing
- Sorvall Legend RT+ refrigerated centrifuge or equivalent (for centrifugation of 15and 50 mL conical centrifuge tubes)
- 2 Liter (or larger) vacuum flask connected to house vacuum
- Short glass Pasteur pipets or regular [non-filtered] pipets tips at the end of [non-filtered] serological pipettes for vacuum aspiration of wash supernatants
- Empty 2 mL FastPrep® tubes and caps, Cat nos., 115076400 and 115064002 (MP Biomedicals)
- DNase-free 2.0 mL microcentrifuge tubes
- FastPrep®-24 Instrument (MP Biomedicals) or comparable homogenizer
- 15 mL conical centrifuge tubes for DNA binding step
- Benchtop centrifuge capable of spinning 2.0 mL tubes
- Micro pipettors
- Aerosol resistant micropipette tips
- Latex or nitrile gloves
- Vortex Mixer
A3. Reagents
- Powdered Alconox® laboratory glassware detergent, Part no. EW-17775-0 (Cole-Parmer)
- 1.0% Alconox stock solution (Appendix 1)
- 0.1% Alconox produce wash solution (Appendix 1)
- FastDNA® SPIN Kit for Soil, Part no. 6560-200 (MP Biomedicals)
- 100% ethanol for DNA extraction procedure
- Sterile nuclease free deionized water for produce wash procedure
B. Cyclospora cayetanensis Real-Time PCR Detection Method
B1. Equipment and Supplies
- Applied Biosystems 7500 Fast Real-Time PCR System with Software versions 1.4, 2.0, or 2.3 or newer
- Applied Biosystems MicroAmp® Fast 8-Tube Strip, 0.1 mL and MicroAmp® Optical 8-Cap Strips, Cat Nos. 4358293 and 4323032 (ThermoFisher Scientific) or equivalent, OR Applied Biosystems MicroAmp® Fast Optical 96-Well Reaction Plates, 0.1 mL, and MicroAmp® Optical Adhesive Film, Cat Nos. 4346907 and 4311971 (ThermoFisher Scientific) or equivalent
- Benchtop centrifuge capable of spinning 96-Well reaction plates or a mini-centrifuge capable of spinning 0.1 mL tube strips
- Benchtop centrifuge capable of spinning 1.5-2.0 mL tubes
- Micropipettors
- Aerosol resistant micropipette tips
- Latex or nitrile gloves
- Vortex Mixer
- DNase-free microcentrifuge tubes, 1.5 mL, low retention
B2. Reagents
- PrimeTimeTM Gene Expression Master Mix (IDT) (Cat. No 1055770 (1 x1 ml) or Cat No. 1055772 (1 x 5 ml).
- Separate tubes of reference dye (ROX) are included with the master mix and need to be added to the master mix as a low reference dye for Applied Biosystems 7500 Fast Real-Time PCR instruments following the manufacturer instructions before use.
- Sterile DNase-free TE buffer pH 7.5 (commercially prepared or see Appendix 2).
- Primers, 500 µM stock solution (See Table 1 and Table 2).
- Probes, 100 µM stock solution (See Table 3).
- IAC Target (HMultra130-synIAC), working concentration 1E7 copies/µL. See Reagent Ordering and Preparation Instructions, Section 3.
- Positive control (Mit1AA gblock), 5E2 copies/µL. See Reagent Ordering and Preparation Instructions, Section 3.
- Negative control (Water, DNase-free).
B3. Reagent Ordering and Preparation Instructions
All Primers, Probes, and Target control DNAs are commercially synthesized by Integrated DNA Technologies (IDT), Coralville, IA. They could also be ordered from an equivalent manufacturer based on the same specifications.
B3A. Primers
All primers are ordered from IDT normalized to a working concentration of 500 µM and stored at -20°C.
- Primer Ordering Instructions
- Choose "Custom DNA Oligos" from the IDT online Order Menu page.
- From the "Normalization" drop down menu:
-
- Choose "Create a custom formulation"
-
- Choose "Full product yield, to a specified µMolar concentration"
-
- Enter "500" and choose "IDTE 8.0 pH"
-
- Name the normalization "500 µM" and Save.
- Next, on the Oligo Entry page enter the primer options as indicated below for each primer:
Table 1. Primer Ordering Instructions
TODO
Table 2. Primer Names and Sequences
TODO
B3B. Probes
Taqman-style hydrolysis probes are used for detection of the C. cayetanensis and IAC targets. The C. cayetanensis probe is labeled with 5’ FAM reporter dye and is double quenched with an internal ZEN quencher and 3’ Iowa Black® FQ (IABkFQ) quencher. The IAC probe is labeled with 5’ Cy5 reporter dye is double quenched with an internal TAO quencher and 3’ Iowa Black® RQ-Sp (IAbRQSp) quencher. Probes are ordered from IDT and hydrated to working concentrations as described below and stored at -20° C.
- Probe Ordering Instructions
- Probes are ordered from the IDT online order menu page by choosing "Custom qPCR Probes"
- Choose PrimeTime qPCR Probes
- Choose 250 nmol or 1 µmol scale.
- Enter probe nucleotide sequence and choose "5’ Dye/3’ Quencher" options as indicated for each probe in Table 3. (No "Services" options are required.)
Table 3. Probe Ordering Information
TODO
- Preparation of Probe Working Solutions
- 100 µM Mit1P-FAM: Hydrate the lyophilized probe in sterile DNase-free TE buffer by adding the volume specified on the accompanying IDT probe specification sheet for a 100 µM final concentration. Vortex and centrifuge the hydrated probe briefly.
- 100 µM dd-IAC-Cy5: Hydrate the lyophilized probe in sterile DNase-free TE buffer by adding the volume specified on the accompanying IDT probe specification sheet for a 100 µM final concentration. Vortex and centrifuge the hydrated probe briefly.
B3C. IAC Target
The IAC reaction target (HMultra130-synIAC) is a synthetic 200 bp ultramer DNA sequence based on the internal amplification control developed by Deer et al., (2010).
- Ordering Instructions
- From the IDT online order menu page choose "Ultramer Oligos (up to 200 bases)"
- On the Oligo Entry page enter or choose the following:
Table 4. Ultramer Oligo Description
TODO
- Sequence
TACAGCACCCTAGCTTGGTAGAATCGATCAGCTACGTGAGGTCCTACGACGATCGCCAAGCATGCCCTAGCTAAGATGCATCGATTGCTCATCACGTACGTTAGGTCGACTAGGAGGACTGGAGTGCATCGACTAGCTAAGATGGTTCGATTGCTCATCACGAAGGTTAGGTCGACTACGAACGAGTCGTATTGCAGGTT- Preparation of IAC Target Working Solution
- Hydrate the ultramer and prepare dilutions in TE pH 7.5 dilution buffer according to Appendix 3 to obtain the working concentration of 1E7 copies/µL. Store dilutions at -20° C.
B3D. Positive Control
The positive control DNA (Mit1AA gblock) is a 245 bp double stranded synthetic gBlocks® Gene Fragment synthesized by IDT or from a different supplier based on these specifications: The sequence corresponds to a region (4325 bp - 4569 bp, Genbank: KP231180.1) in the C. cayetanensis Mitochondrial gene. In addition, this sequence contains traceable mutations (T4385A and T4386A) within the amplicon generated by the real-time PCR primers used in this protocol.
- Ordering Instructions
-
From the IDT online order menu page choose "gBlocks Gene Fragments".
-
Enter the following item name and sequence on the gBlocks® Gene Fragments Entry page:
-
- Item Name
- Mit1AA gblock
- Sequence
ACAGTTGGTTTTCTATTTTCACCATTCTTGCTCACTGTATTAGTATTATTTAATTTTACTAATAGAGAAGTTGGTACTACATCAGCTTCTCTGGTTTCATCAATTTGTTTAGGTGTTATTAGTACTGAGTTACTACTATTTGTTAGCTTCTTCTGGGGTGCATACACCAGCATTCTATCTCCTAGTTATGTAACAGACTCCACCCTAGTAAGTCCAACTGAGGGTCTTGTAAGTATCTCTAGTAG
-
Click "Add to Order"
-
Answer "No" to all questions on the Terms and Disclosure pop up window
-
Type your name in the Signature box → accept the terms and conditions
-
Click "Add to Cart". The amount delivered will be 250 ngrams of the gBlock.
- Preparation of Working Solution
-
Hydrate the gBlock and prepare dilutions according to Appendix 4 to obtain the working solution concentration of 5E2 copies/µL.
-
The positive control working solution can be stored at -20°C or 4°C.
-
A fresh working solution should be prepared from the frozen 5E3 dilution every 90 days.